DNA Recommendations

Complex (hgvs/iscn) Variant


Definitions

Complex
a sequence change where, compared to a reference sequence, a range of changes occur that can not be described as one of the basic variant types (substitution, deletion, duplication, insertion, conversion, inversion, deletion-insertion, or repeated sequence).

Description

Sequence changes can be very complex, involving a range of changes at one specific location. Complex changes, including translocations, should be described using the recommendations of the accepted HGVS nomeclature named extension ISCN (see SVD-WG004 (ISCN<>HGVS)). The ISCN extension has been developed in collaboration with and are based on those of the 2016 Standing Committee on Human Cytogenomic Nomenclature (ISCN), covering the description of numerical and structural chromosomal changes detected using microscopic and cytogenetic techniques. NOTE: The description of cpmplex changes can become rather complicated and at some point, although literally correct, effectively meaningless.


Examples

The basis of the examples is from Community Consultation proposal SVD-WG004. To simplify descriptions genomic reference sequences are indiacted as e.g. “chr4” (representing NC_000010.10 (hg19))

  • translocations
    • balanced
      • t(2;11)(p25.1;p15.2)
        (involving short arms chromosomes 2 and 11)
        g.[chr2:pter_8247756::chr11:15825273_cen_qter] (der11)
        and g.[chr11:pter_15825272::chr2:8247757_cen_qter] (der2)
      • t(2;11)(q31.1;q22.3)
        (involving long arms chromosomes 2 and 11, with 5 bp deletion of chr11 sequence)
        g.[chr2:pter_cen_174500098::chr11:108111987_qter] (der2)
        and g.[chr11:pter_cen_108111981::chr2:174500099_qter] (der11)
        NOTE: coupling chr11:108111981 to 108111987 implies nucleotides 108111982_108111986 are deleted
      • t(3;14)(14qter->14q12::3p22.2->3qter;14pter->14q12::3p22.2->3pter)
        (between short arm chromosome 3 and long arm chromosomes 14, with an inserted sequence at the break point on the derivative chromosome 3)
        g.[chr14:pter_cen_29745313::chr3:pter_36969141inv] (der14)
        and g.[chr14:29745314_qterinv::CATTTGTTCAAATTTAGTTCAAATGA::chr3:36969142_cen_qter] (der3)
      • t(9;9)(9qter->9q22.33::9p21.2->9qter;9pter->9q22.33::9p21.2->9pter)
        (between homologous chromosomes, based on Ordulu et al. example)
        g.[chr9:102425452_qterinv::chr9:26393002_cen_qter]
        and g.[chr9:pter_cen_102425451::chr9:26393001pterinv]
    • unbalanced
      • der(2)t(2;11)(p25.1;p15.2)
        (derivative chromosome 2, translocation between short arms chromosomes 2 and 11)
        g.chr2:pter_8247756delinschr11:pter_15825266
      • der(3)(3pter->3q25.32::8q24.21->8qter)
        (derivative chromosome 3, translocation between long arms chromosomes 3 and 8, with an estimated nucleotide range for the break point on chromosome 8, based on Uncertain Break point Localization example from Ordulu et al.)
        g.chr3:158573187_qterdelinschr8:(128534000_128546000)_qter
      • der(5)t(5;10)(p13.3;q21.3)
        (derivative chromosome 5, translocation between short arm chromosome 5 and long arm chromosome 10 with homology at the break point (chr5 29658440_29658442 and chr10 67539995_67539997), based on Homology examples in Ordulu et al.)
        g.chr5:pter_29658442delinschr10:67539995_qterinv
  • inversion, pericentric
    • inv(6)(pter->p25.3::q16.1->p25.3::q16.1->qter)
      (with substitution at break point)
      chr6:g.[776788_93191545inv;93191546T>C]
    • inv(2)(pter->p22.3::q31.1->p22.3::q31.1->qter)dn
      (de novo, with 275bp deletion and 1bp insertion at break points)
      chr2:g.[32310435_32310710del;32310711_171827243inv;insG]
      NOTE: the HGVS description does not include the de novo occurence of the variant
  • deletion
    • del(X)(q21.31q22.2)
      (within a chromosome, breakpoint not sequenced)
      chrX:g.(86200001_103700000del
    • r(22)(p11.1q13.1)
      (ring chromosome derived from chromosome 22, breakpoint not sequenced)
      chr22:g.pter_(12200001 _14700000)del::(37600001_410000000_qterdel
      NOTE: “::” is used to indicate the join instead of “;” to describe two not connected deletions
  • insertion
    • duplication (tandem)
      • dup(8)(q24.21q24.22)
        (within a chromosome, breakpoint not sequenced)
        chr8:g.(127300001_131500000)_(131500001_136400000)dup
      • dup(8)(q24.22q24.21)
        (within a chromosome, orientation reversed relative to original sequence, breakpoint not sequenced)
        chr8:g.(131500001_136400000)ins(127300001_131500000)_(131500001_136400000)inv
    • insertion
      • der(4)ins(4;X)(q28.3;q22.2q21.31)
        (inserted sequence reversed in orientation relative to chromosome sequence containing centromere)
        g.chr4:134850793_134850794inschrX:89555676_100352080inv
    • transposition
      • balanced (deletion + insertion elsewhere)
        • ins(4;X)(q28.3;q21.31q22.2)
          (balanced intrachromosomal, inserted sequence same orientation as chromosome sequence containing centromere, based on Ordulu et al. Fig.1C)
          g.[chr4:134850793_134850794inschrX:89555676_100352080] and chrX:g.[89555676_100352080del]
        • ins(4;X)(q28.3;q22.2q21.31)
          (balanced intrachromosomal, inserted sequence reversed in orientation relative to chromosome sequence containing centromere)
          g.[chr4:134850793_134850794inschrX:89555676_100352080inv] and chrX:g.[89555676_100352080del]
      • unbalanced (copy inserted elsewhere)
        describe as insertion
  • additional chromosome
    • +r(22)(p11.1q13.1)
      (supernumerary ring chromosome derived from chromosome 22, breakpoint not sequenced)
      chr22:g.[pter_(12200001 _14700000)del::(37600001_410000000)_qterdel]add
    • 46,XY,upd(14)mat
      (uniparental disomy, additional copy of maternal chromosome 14)
      chr14:g.[pter_cen_qter]add
      NOTE: the HGVS description does not include the maternal origin of the additional chromosome

Q&A

What is ISCN?

ISCN is short for the International System for human Cytogenetic Nomenclature, covering the description of numerical and structural chromosomal changes detected using microscopic and cytogenetic techniques. The recommendations are prepared by the International Standing Committee on Human Cytogenetic Nomenclature and published in collaboration with the journal Cytogenetic and Genome Research (since 1963). The committee includes three members from the Americas, three from Europe, one from Asia, and one from Africa/Australia/Oceania. Members are elected for a 5 year period, unless developments demand earlier changes. The organization of the submission of nominations, ballots for voting and election of members is the responsibility of the existing Editor and Committee chair.
The latest recommendations, ISCN2013, were finalized by the ISCN2013 committee and its advisors at a meeting in Seattle (Washington) in April 2012. The ISCN2013 recommendations are available as book from Karger Publishers (Eds. Lisa G Shaffer, Jean McGowan-Jordan & Michael Schmid). Questions/suggestions regarding the ISCN recommendations should be addressed to Jean McGowan-Jordan (Ottawa, Canada), chair of the ISCN committee.
  • current ISCN committee
    Chair: Jean McGowan-Jordan (Ottawa, Canada)
    Members: Jaclyn Biegel (Philadelphia, USA), Myriam Chaabouni (Tunis, Tunisia), Johan T den Dunnen (Leiden, Nederland), Jin-Yeong Han (Busan, South Korea), Nils Mandahl (Lund, Sweden), Kathleen W Rao (Chapel Hill, USA), Annet Simons (Nijmegen, Nederland).
    Advisors: Cynthia C Morton (Boston, USA), Michael Schmid (Wurzburg, Germany)
  • ISCN2013 committee
    Chair: Lisa G Shaffer (Spokane, USA),
    Members: Jaclyn Biegel (Philadelphia, USA), Myriam Chaabouni (Tunis, Tunisia), Johan T den Dunnen (Leiden, Nederland), Jin-Yeong Han (Busan, South Korea), Nils Mandahl (Lund, Sweden), Jean McGowan-Jordan (Ottawa, Canada), Kathleen W Rao (Chapel Hill, USA), Annet Simons (Nijmegen, Nederland)
    Advisors: Lynda J Campbell (Melbourne, Australia), Michael Schmid (Wurzburg, Germany).

Is the description NM_04006.1:c.123+45_123+51TSDinsL1.603bp acceptable (TSD = target site duplication, insL1 indicates the nature of the insert (L1, Alu or SVA), 603bp = the number of inserted base pairs)?

No, not realy, it is not exact. Following HGVS recommendations the description should be like NG_012232.1(NM_004006.1):c.123+45_123+51dupinsXXXXXX.x:g.393_1295. So give a genomic reference sequence to describe the intronic variant, use "dup" (not "TSD") and exactly describe the insertion, not like "insL1.603bp". In the example XXXXXX.x is a GenBank file (accession.version number) containing the inserted L1 sequence (nucleotides g.393_1295).